Products
Virus Packaging
Cloning Services
Other Services
Resources
About US
 Current Location:Home > Products > Adenovirus 
             
        
                Gene No.:   NM_207013
                        Cat No.:   VH805183
                        Gene Name:   TCEB2
                        Gene Length:   486 bp
                       
                        Price:   Quote400-077-2566
                        Turnaround Time:   Inquire
						Verify:  No						 
						
Product name: Premade Adenovirus of Human ORFs
	
 
Specifications: Titer:≥1×10E12vp/mL;Volume:500ul
	
 
Shipping & Storage Conditions:
Product(s) shipped on dry ice. Once received, please store at -80℃ for long-term storage. Please note, Aliquot to avoid repeated freezing and thawing that can decrease the viral titer. Prior to use, please melt it(or them) at 4℃ and mix gently to ensure a uniform concentration of components.
Once an aliquot is thawed, it may be stored at 4°C for several weeks without significant loss of biological activity.
	
 
Storage Buffer:PBS
	
 
Biosafety level:Biosafety level (BSL)-2
	
 
Shelf life:1 year from date of receipt under proper storage conditions
	
 
Note:If you have any questions about how to use the product, please refer to our adenovirus manual or contact our technical support. Our email address is techsupport@wzbioscience.com.
ATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCTTCACGGACGCCAAGGAGTCCAGCACGGTGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCTCCTGACGAGCAGCGGCTGTACAAGGATGACCAACTCTTGGATGATGGCAAGACACTGGGCGAGTGTGGCTTCACCAGTCAAACAGCACGGCCACAGGCCCCAGCCACAGTGGGGCTGGCCTTCCGGGCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTTCCAGCCCGCCAGAGCTGCCCGATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAACAAGCCGTGCACCTGCATGTCCACTCCCAGACGATGGCCAAGAGCAGAAACACAAGCTGGAGCCAGTGTCCTGGTTTGACAGCATGTTCAACGAGGGAACCCCAAGACGGACCCACACAGGTCCACCCACGCTGGGGGCTG
MDVFLMIRRHKTTIFTDAKESSTVFELKRIVEGILKRPPDEQRLYKDDQLLDDGKTLGECGFTSQTARPQAPATVGLAFRADDTFEALCIEPFSSPPELPDVMKPQDSGSSANEQAVHLHVHSQTMAKSRNTSWSQCPGLTACSTREPQDGPTQVHPRWGL
Waiting for Upload……
WZ Biosciences' products are to be used only for research purpose only. They may not be used for any other purposes, including, but not limited to, in vitro diagnostic purposes, therapeutics, or in humans.
	
 
	WZ Biosciences' products may not be transferred to any third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to other third parties without prior written approval from WZ Biosciences, Inc.
Your use of this product is also subject to compliance with the licensing requirements listed above and described on the product's web page at http://www.wzbio.com. It is your responsibility to review, understand and adhere to any restrictions imposed by these statements.