Products
Virus Packaging
Cloning Services
Other Services
Resources
About US
Current Location:Home > Products > Adenovirus
Gene No.: NM_001123068
Cat No.: VH812402
Gene Name: PPIAL4G; BX284650.5; FLJ16804; MGC163248; MGC163250; PPIAL4A
Gene Length: 495 bp
Price: $1495
Turnaround Time: 3-4 weeks
Verify: No
Product name: Premade Adenovirus of Human ORFs
Specifications: Titer:≥1×10E12vp/mL;Volume:500ul
Shipping & Storage Conditions:
Product(s) shipped on dry ice. Once received, please store at -80℃ for long-term storage. Please note, Aliquot to avoid repeated freezing and thawing that can decrease the viral titer. Prior to use, please melt it(or them) at 4℃ and mix gently to ensure a uniform concentration of components.
Once an aliquot is thawed, it may be stored at 4°C for several weeks without significant loss of biological activity.
Storage Buffer:PBS
Biosafety level:Biosafety level (BSL)-2
Shelf life:1 year from date of receipt under proper storage conditions
Note:If you have any questions about how to use the product, please refer to our adenovirus manual or contact our technical support. Our email address is techsupport@wzbioscience.com.
cgccatggtcaactccgtcatcttttttgacatcaccgtcgacggcaagcccttgggccgcatctccatcaaacagtttgcagacaagattccaaagacagcagaaaactttcgtgctctgagcactggagagaaaggatttcgttataagggttcctgctttcacagaattattccagggtttatgtgtcagggtggtgacttcacacaccctaatggcaccggtgacaagtccatctatggggagaaatttgatgatgagaacctcatccgaaagcatacaggttctggcatcttgtccatggcaaatgctggacccaacacaaatggttcccagtttttcatctgcactgccaagactgagtggttggatggcaagcatgtggcctttggcaaggtgaaagaacgtgtgaatattgtggaagccatggagcactttgggtacaggaatagcaagaccagcaagaagatcaccattgctgactgtggacaattca
MVNSVIFFDITVDGKPLGRISIKQFADKIPKTAENFRALSTGEKGFRYKGSCFHRIIPGFMCQGGDFTHPNGTGDKSIYGEKFDDENLIRKHTGSGILSMANAGPNTNGSQFFICTAKTEWLDGKHVAFGKVKERVNIVEAMEHFGYRNSKTSKKITIADCGQF
Waiting for Upload……
WZ Biosciences' products are to be used only for research purpose only. They may not be used for any other purposes, including, but not limited to, in vitro diagnostic purposes, therapeutics, or in humans.
WZ Biosciences' products may not be transferred to any third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to other third parties without prior written approval from WZ Biosciences, Inc.
Your use of this product is also subject to compliance with the licensing requirements listed above and described on the product's web page at http://www.wzbio.com. It is your responsibility to review, understand and adhere to any restrictions imposed by these statements.