Products

Virus Packaging

Cloning Services

Other Services

Resources

About US

Current Location:Home > Products > Plasmid

Human mir23a in pMIR Plasmid Vector, 500uL glycerol stock

Gene No.: MIMAT0000078
Cat No.: CR201256
Gene Name: mir23a; mir-23a
Gene Length: 372 bp
Price: $298
Turnaround Time: next day

  • Product Information
  • Mature Sequence
  • Cloning Sequence
  • Note To Purchase
Product name: Human microRNA Clone

Specifications: 500ul Glycerol Stock

Shipping & Storage Conditions:
Product shipped at ambient temperature. Upon receiving, please store at -80 degree for long-term storage.

Product features:
1.miRNA precursor has 150-200bp of flanking sequence and the miRNA hairpin sequence;
2.For each miRNA, tranfection has been tested, green fluorescent has been observed;
3.All the mirRNA clones contains puromycin gene for stable cell line construction;
4.All the mirRNA clones includes kanamycin gene for positive clone selection. Its recommended working concentration is 30 ug/mL.

Handling instruction:
Streak the bacteria onto an LB agar plate. Incubate at 37 °C for overnight. Inoculate a single colony into fresh LB medium and culture overnight at 37 °C in a shaking incubator. Then extract the plasmid and sequence verification.
PS: We recommend that you should sequence it(them) upon receiving your plasmid(s).

Note:If you have any questions about how to use the product, please contact our technical support. Our email address is techsupport@wzbioscience.com.

AUCACAUUGCCAGGGAUUUCC

GAGGGCACAGCTAGGCTCCAGCTCCCCGTGTGGTGGCTCCTGCATATGAGAAAAGAGCTTCCCTGTGATCAAAGGAAGCATCTGGGGACCTGGAGGGGAGGTGTCCCCAAATCTCATTACCTCCTTTGCTCTCTCTCTCTTTCTCCCCTCCAGGTGCCAGCCTCTGGCCCCGCCCGGTGCCCCCCTCACCCCTGTGCCACGGCCGGCTGGGGTTCCTGGGGATGGGATTTGCTTCCTGTCACAAATCACATTGCCAGGGATTTCCAACCGACCCTGAGCTCTGCCACCGAGGATGCTGCCCGGGGACGGGGTGGCAGAGAGGCCCCGAAGCCTGTGCCTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGC

WZ Biosciences' products are to be used only for research purpose only. They may not be used for any other purposes, including, but not limited to, in vitro diagnostic purposes, therapeutics, or in humans.


WZ Biosciences' products may not be transferred to any third parties, resold, modified for resale, or used to manufacture commercial products or to provide a service to other third parties without prior written approval from WZ Biosciences, Inc.
Your use of this product is also subject to compliance with the licensing requirements listed above and described on the product’s web page at http://www.wzbio.com. It is your responsibility to review, understand and adhere to any restrictions imposed by these statements.